According to Ray Bradbury's story "August 2016: There Will Come Soft Rains," how are people living in close proximity to a nuclear disaster affected?

After nuclear bombs were dropped on Hiroshima and Nagasaki during WWII, scientists and the military discovered that objects and people within a close radius of the point of impact created what are called “nuclear shadows.”  The UV rays from a nuclear bomb will “bleach” out everything around it, much like an x-ray produces a negative.  For example, if a person is standing between the blast and a building, a shadow will be created of the...

After nuclear bombs were dropped on Hiroshima and Nagasaki during WWII, scientists and the military discovered that objects and people within a close radius of the point of impact created what are called “nuclear shadows.”  The UV rays from a nuclear bomb will “bleach” out everything around it, much like an x-ray produces a negative.  For example, if a person is standing between the blast and a building, a shadow will be created of the person on the wall of the building.  

This is what happened to the family in “There Will Come Soft Rains.”  Here is Bradbury’s description of the event: 

The entire west face of the house was black, save for five places. Here the silhouette in paint of a man mowing a lawn. Here, as in a photograph, a woman bent to pick 3 flowers. Still farther over, their images burned on wood in one titanic instant, a small boy, hands flung into the air; higher up, the image of a thrown ball, and opposite him a girl, hands raised to catch a ball which never came down. The five spots of paint—the man, the woman, the children, the ball—remained. The rest was a thin charcoaled layer.

Bradbury’s image of the last remaining moments of the family shows how death was instant.  The family’s shadows are permanently etched into the wall while they are still in full motion.  The family playing catch, picking flowers, and mowing the lawn sets the scene that is in opposition to the destructiveness of the nuclear bomb.  Unfortunately, after the blast, all that is left are their silhouettes like “charcoal” on the home’s wall.   

I have included a website with pictures from Hiroshima and Nagasaki below. 

How can you explain the rise of Napoleon?

Several factors led to Napoleon’s rise to power. First, Napoleon’s success directly correlates to the French Revolution because such a political climate enabled Napoleon, despite his modest upbringing, to become an Emperor. While in years prior only the elite could participate in the government, the French Revolution challenged long-held ideals which favored the aristocracy's sole involvement in politics and matters of the state. Accordingly, someone like Napoleon was actually allowed (and encouraged) to enter the...

Several factors led to Napoleon’s rise to power. First, Napoleon’s success directly correlates to the French Revolution because such a political climate enabled Napoleon, despite his modest upbringing, to become an Emperor. While in years prior only the elite could participate in the government, the French Revolution challenged long-held ideals which favored the aristocracy's sole involvement in politics and matters of the state. Accordingly, someone like Napoleon was actually allowed (and encouraged) to enter the political arena. At the same time, Napoleon was a gifted military strategist, and after his initial rise to power, he demonstrated his talents in various military campaigns in Italy and Egypt. In 1799, Napoleon and his supporters overthrew the Directory Government of France, thus officially marking Napoleon’s reign. Napoleon was also married to Josephine, whose well-connected Father was a member of the Directory Government. This relationship allowed Napoleon access to the inner workings of the state, while also contributing to Napoleon’s popularity with the masses. In short, the unstable political landscape in France, Napoleon’s ambitious nature, and political/personal affiliations all paved the way for his popularity and subsequent reign.

A double stranded fragment of viral DNA, one of whose strand is shown below, encodes two peptides, called vir-1 and vir-2. Adding this...

First, we need to write out the complimentary strand to the strand shown. We can already tell, just by looking at the strand provided, that vir1 will be encoded on one of the strands, and vir2 will be coded on the complimentary strand; we know this because each sequence needs to begin with the DNA sequence TAC, but in the strand provided, there are two TAC sequences that are too close together to provide both...

First, we need to write out the complimentary strand to the strand shown. We can already tell, just by looking at the strand provided, that vir1 will be encoded on one of the strands, and vir2 will be coded on the complimentary strand; we know this because each sequence needs to begin with the DNA sequence TAC, but in the strand provided, there are two TAC sequences that are too close together to provide both a 10 and a 5 residue product.

Following the GCAT pairing rules, we get the double strand:

1. AGATCGGATGCTCAACTATATGTGATTAACAGAGCATGCGGCATAAACT

2. TCTAGCCTACGAGTTGATATACACTAATTGTCTCGTACGCCGTATTTGA

We know strand one must be read right-to-left, because this is the only way a TAC sequence appears. Therefore, strand 2 must be read left-to-right. The TAC sequences are highlighted below:

1. AGATCGGATGCTCAACTATATGTGATTAACAGAGCATGCGGCATAAACT

2. TCTAGCCTACGAGTTGATATACACTAATTGTCTCGTACGCCGTATTTGA

Since it's not immediately obvious which TAC is the correct one, we can look for stop sequences as well. Stop, in DNA, is encoded by TAG, TAA and TGA

1. AGATCGGATGCTCAACTATATGTGATTAACAGAGCATGCGGCATAAACT

2. TCTAGCCTACGAGTTGATATACACTAATTGTCTCGTACGCCGTATTTGA

If we look carefully at these sequences, we can eliminate some that are situated in such a way that they are incompatible with the TAC sequences and with the 10 and 5 residue products we expect. Some of them are also not found in the same 3-base sequence when counted from a given TAC starting point. However, none of the possible sequences provide a 10-residue or 5-residue product. I believe this was due to the original sequence being written or assigned incorrectly; researching this question online shows that it appears in multiple forms, some of which are not possible to transcribe using the criteria shown. Furthermore, other versions of this question show the original sequence as being 5' to 3', and since DNA is always transcribed 5' to 3', this means a TAC sequence needs to be visible in left-to-right viewing in order for this question to be solved. 

How does Keller's statement in paragraph one that she has a “hesitation in lifting the veil that clings about my childhood like a golden mist”...

Keller is expressing a certain reluctance in writing about her life, especially the part when she was very young, before the fever that took away her sight and hearing. This is a little unexpected, since she is a celebrated person and engaged in writing an autobiography. She says that she is afraid that significant moments of her childhood she might misremember; other significant moments she has forgotten completely. I don't think she hesitates because of...

Keller is expressing a certain reluctance in writing about her life, especially the part when she was very young, before the fever that took away her sight and hearing. This is a little unexpected, since she is a celebrated person and engaged in writing an autobiography. She says that she is afraid that significant moments of her childhood she might misremember; other significant moments she has forgotten completely. I don't think she hesitates because of a fear of inaccuracy, though. When she talks about the "veil" that is around her childhood "like a golden mist," she means her memory, but more than that, she is trying to explain the fragile and precious nature of these memories. These are very personal things for her to share, and in writing them down, there is a sense that they might become damaged or abused at the hands of her reader. Yet Keller, who for years was shut away from communicating with anyone in any form, must take that chance. So the tone of this first chapter is happy, but tinged with apprehension and a certain vulnerability. Mostly, what I get from it is a sense of Keller's amazing courage.

In the Ernest Hemingway short story "A Day's Wait," why does Hemingway give so much attention to the details of his activities outside after giving...

Ernest Hemingway's “A Day's Wait” is about a boy who thinks he is dying. He has really just misunderstood the meaning of his 102 degree fever, but for a full day he lives with the premise that he will soon die.

Your question is a good one. Hemingway was never one to over-explain things, so when we hear the narrator describing his hunting excursion of a few hours while his son is at home with...

Ernest Hemingway's “A Day's Wait” is about a boy who thinks he is dying. He has really just misunderstood the meaning of his 102 degree fever, but for a full day he lives with the premise that he will soon die.

Your question is a good one. Hemingway was never one to over-explain things, so when we hear the narrator describing his hunting excursion of a few hours while his son is at home with a mild case of the flu, but thinking he is dying (unbeknownst to the father), we can't help but wonder what Hemingway is up to.

One possibility is that Hemingway wants to juxtapose the father's relatively trivial activity and pleasure with the turmoil that the boy must be going through. Does the boy know his father has gone hunting while he is in the process of dying (at least in his own mind)? Hemingway doesn't tell us if the boy knows or not.

Another possibility is that Hemingway wants to make a point of how we go through our days doing things that don't really amount to much, when we all have such a momentous event in our future—our own death, still ahead of us.

Perhaps Hemingway just wanting to give his story a buffer between the two key moments in the story: the boy's misunderstanding, followed by his father's explanation. This gives the reader some time to subconsciously reflect on what must be going on in the boy's mind. Then, when the father tells him what's really happening, we feel a sense of compassion for the boy, who had to struggle through all that time thinking he was dying.

What does the valley of ashes represent?

Considering the misery of the people who live in the valley of ashes (Myrtle Wilson, who has an affair with Tom Buchanan because she desperately wants to get away from the valley and her husband, and George Wilson, who is constantly worried about money and is later made sick by the knowledge that his wife has been cheating on him) as well as the fact that the ashes are produced by industry (the industry that...

Considering the misery of the people who live in the valley of ashes (Myrtle Wilson, who has an affair with Tom Buchanan because she desperately wants to get away from the valley and her husband, and George Wilson, who is constantly worried about money and is later made sick by the knowledge that his wife has been cheating on him) as well as the fact that the ashes are produced by industry (the industry that makes many others filthy rich), the valley of ashes -- with its location so near the two Eggs -- seems to symbolize the miserable position of the poor, working class during this era. 

Judging by the Eggs, East and West, the wealthy are only getting richer and richer while the valley implies that the poor remain stuck, used up, and burned out.  The valley also helps to show the huge discrepancy between the haves and have nots, the impossibility of the American Dream for some.  A few, perhaps, those who live in West Egg, have achieved the Dream: the idea that through hard work, a person can achieve success and prosper.  However, George Wilson works very hard, and it seems to have no effect whatsoever on his livelihood.  He remains poor and unhappy, despite his hard work and initiative (when he speaks to Tom over and over about buying his car).  Wilson cannot reach the American Dream; it is simply unavailable to everyone, and the valley symbolizes this corruption of the dream as well.

Do any enzymes exist that are made of something other than protein, DNA or RNA?

Enzymes are proteins, and are made up chains of amino acids like other proteins. However, there have been some other discoveries that cause us to deviate from that definition slightly.  Molecules called ribozymes have been found in nature that are small segments of RNA that can catalyze reactions and therefore act like enzymes. For example, the part of the ribosome that links amino acids together acts like a ribozyme. Because of their ability to carry...

Enzymes are proteins, and are made up chains of amino acids like other proteins. However, there have been some other discoveries that cause us to deviate from that definition slightly.  Molecules called ribozymes have been found in nature that are small segments of RNA that can catalyze reactions and therefore act like enzymes. For example, the part of the ribosome that links amino acids together acts like a ribozyme. Because of their ability to carry genetic information and catalyze reactions, ribozymes are studied closely as a possible clue to the beginnings of self-replicating systems in early life. 

In nature, we do not yet know of any natural enzymes made up of DNA, but they have been made artificially in the lab, as is seen in the paper I've referenced below. These molecules are referred to as deoxyribozymes. Both ribozymes and deoxyribozymes are interesting to researchers for their possible applications in living systems as tools for research or even therapeutic agents. 

Many enzymes require cofactors or coenzymes in order to function properly. Cofactors and coenzymes can be inorganic, such as metal ions, or organic such as vitamins, or even derived from other proteins. These are not part of the chain(s) of amino acids that make up the enzyme, but they bind to the enzyme at a binding site. 

In short, protein, RNA and DNA covers the range of materials that enzymes can be made up of for now. I say, 'for now' because new discoveries are always being made so my explanation could be proven wrong in the future. Remember that other molecules can be used as cofactors and coenzymes, but they are not generally considered to be part of the enzyme itself.

In what important ways is the setting of the final frontier different from Earth in Tom Godwin's short story "The Cold Equation"? Is Godwin's space...

In his short story "The Cold Equations," Tom Godwin describes his setting of the final frontier, or outer space, in a way that it remarkably resembles locations on Earth, especially during the days of colonization and imperialism. The only real difference between the planets in space being explored and colonized and the locations on Earth that were explored and colonized is that there is substantial distance between locations in space. The distance is so great that colonists and explorers had even fewer chances of surviving in space than they did in their new settlements on Earth in the colonial days.

Distance is an important aspect of Godwin's description of outer space as a setting because he notes that, as the galaxy continued to be explored, colonists and explorers in their different locations became more and more isolated:

Galactic expansion had followed the development of hyperspace drive, and as men scattered wide across the frontier, there had come the problem of contact with the isolated first colonies and exploration parties.

These isolated colonists and explorers had, from time to time, emergency situations, and it was too expensive for hyperspace cruisers to make emergency, unscheduled visits. Therefore, Emergency Dispatch Ships were built, carrying limited fuel supplies, and their limited fuel supply creates the conflict of the story.

In contrast, while colonists in our own days of colonization also had their own emergency situations, most colonists were able to get the emergency supplies they needed because the distances between the colonies and the mother countries were not that great, and plenty of ships were involved in the exploration and colonizing process. Only some colonies completely failed, leading to total death, such as Jamestown in Virginia and several in the Caribbean ("Failed Colonies," National Humanities Center).

Despite the difference in distance, Godwin's setting closely resembles locations found on Earth because he describes the explorers as suffering from such things as tornadoes and being "stricken with the fever carried by the green kala midges," a description that sounds remarkably like malaria carried by a parasite that infects female mosquitoes. Due to these similarities, while Godwin's setting may not be completely believable as a realistic description of planets in the galaxy, his setting is certainly relatable.

What risks does Scout take in Harper Lee's To Kill a Mockingbird?

Scout takes one risk in deciding to join the boys on their adventure sneaking onto the Radleys' property to try to get a look at Arthur (Boo) Radley in Chapter 6 of Harper Lee's To Kill a Mockingbird.Throughout the whole chapter, the boys had involved themselves in antics to try to get Arthur to leave his home, antics Scout severely disapproved of. As a consequence of her disapproval, the boys spent most...

Scout takes one risk in deciding to join the boys on their adventure sneaking onto the Radleys' property to try to get a look at Arthur (Boo) Radley in Chapter 6 of Harper Lee's To Kill a Mockingbird.

Throughout the whole chapter, the boys had involved themselves in antics to try to get Arthur to leave his home, antics Scout severely disapproved of. As a consequence of her disapproval, the boys spent most of their time that summer by themselves, plotting and scheming, while Scout spent time with Miss Maudie. On Dill's last night in town, Scout grows suspicious when Dill invites Jem to "go for a walk" with him. Upon being pressed, the boys confess their plan to try to get a look at Arthur through a window. Scout begs them not to follow through with their plan, but when Jem calls her a girl, and tells her to go home, she refuses, deciding she must join them:

Scout, I'm tellin' you for the last time, shut your trap or go home--I declare to the Lord you're gettin' more like a girl every day! (Ch. 6)

At this point in the story, both Jem and Scout still see being a girl as a symbol of cowardice. Since Scout feels that being cowardly is an insult, she feels she has no choice but to rise to the challenge and join them in the risk are were taking.

The adventure is a harrowing experience that culminates in Nathan Radley chasing them off the property with a shotgun, but all make it off the property in time, sans Jem's pants, which he gets caught on the fence.

How does Ponyboy's opinion of the Socs at the end of Hinton's The Outsiders differ from his opinion at the beginning?

At the beginning of the book, Pony assumes the Socs are all enemies. By the end, he realizes they are just people with problems like everyone else.

As the book opens, Pony is afraid of the Socs, the greasers' rival gang. He thinks they unfairly target greasers. The Socs are the rich kids, and they have all the breaks.

Greasers can't walk alone too much or they'll get jumped, or someone will come by and...

At the beginning of the book, Pony assumes the Socs are all enemies. By the end, he realizes they are just people with problems like everyone else.

As the book opens, Pony is afraid of the Socs, the greasers' rival gang. He thinks they unfairly target greasers. The Socs are the rich kids, and they have all the breaks.

Greasers can't walk alone too much or they'll get jumped, or someone will come by and scream "Greaser!" at them, which doesn't make you feel too hot, if you know what I mean. We get jumped by the Socs. . . the jet set, the West-side rich kids (Chapter 1). 

When Pony meets Cherry, he changes his mind about the Socs, at least to some degree. Cherry tells him everyone has problems, regardless of whether they have money. Social class is not everything. She makes Pony stop and think about the Socs as people, and not just the enemy, when she tells him things are “rough all over.” 

I shook my head. It seemed funny to me that the sunset she saw from her patio and the one I saw from the back steps was the same one. Maybe the two different worlds we lived in weren't so different. We saw the same sunset (Chapter 3). 

This new understanding is somewhat enhanced by the aftermath of the fight in the park when Johnny kills Bob. Johnny and Pony are forced to go on the run. When they return, Pony finds some of the Socs are reacting strongly to the incident. Cherry turns “spy” and tells the judge Bob was drinking and it wasn’t Johnny’s fault. Randy tells Pony he doesn’t want to fight anymore and won't participate in the upcoming rumble, saying,

I'm sick of all this. Sick and tired. Bob was a good guy. He was the best buddy a guy ever had. I mean, he was a good fighter and tuff and everything, but he was a real person too. You dig? (Chapter 7) 

Cherry and Randy both make Pony look at Socs differently, but not in the same way. Cherry makes him realize not all Socs are out to get greasers. Randy makes him realize it is possible for Socs to change. Pony emerges from the experience changed and with a different perspective on the Soc-greaser conflict and the Socs themselves.

What are some examples of ethical issues that you have experienced in jobs? How did the Human Resources office help or not help to resolve them?

An ethical dilemma within the workplace can involve any number of possible scenarios. Let's address, for the purpose of discussion, a common problem that confronts many individuals in many different types of work. That problem involves observing, or hearing through second- or third-parties, that a coworker has stolen from the company. Stealing from one's employer constitutes a relatively common transgression, especially in cash-intensive businesses like restaurants or gasoline service stations. At some point, some employee is going to steal from the company. It could be cash, or it could be merchandise or office equipment, but somebody is going to feel that it's okay to take company property home for his or her own use. The dilemma arises when you become aware of that illicit activity and, consequently, must decide how to respond. A bond between coworkers might exist that precludes you from reporting to your superiors or to Human Resources that you are aware of theft by a fellow employee. You may not know or even like the coworker, but reject the notion of informing on another individual (i.e., becoming a "rat"). You might, therefore, decide to ignore the transgression. Conversely, you might feel it is your responsibility to report the transgression up your chain of command, or to a Human Resources office.

Let's say for the purpose of discussion that a decision is made to report a theft of company property to the Human Resources office. Officials in that office will take a report and, typically, summon the accused individual for an interview, at which time that individual will be informed that he or she was observed stealing. If physical evidence of a crime is absent, and assuming that a polygraph examination is not an option, the H.R. official may have no choice other than to let the accused individual return to his or her job, that individual now aware that a fellow worker has made an accusation against him or her. If, however, evidence of the alleged misconduct does exist, then the Human Resources office may issue a warning to the offending worker, or may terminate that worker's employment status. 

When interviewing for a position, this educator was asked by prospective employers how I would respond to a situation in which I observed a coworker stealing from the company. I responded that I couldn't give a concrete answer, as my moral obligation might involve multiple variables, including the option of confronting that coworker myself to discuss the issue or, possibly, ignoring the matter altogether. My prospective employer accepted my response, as it demonstrated a willingness to deal with a personnel matter personally rather than involving superiors or Human Resources while acknowledging that life can be more complicated than the simple black-and-white scenarios might suggest. In such a scenario, reporting the matter to H.R., the appropriate reaction according to company policy, was not necessarily the "real-life" option that may be selected by an honest, diligent employee.

Human Resources offices have a number of options at their disposal for resolving moral or ethical dilemmas or issues. They can reissue copies of the company's principles and expectations of employees as a reminder to all that certain types of conduct are not tolerated. They can terminate the employment of the offending individual, or they can issue a warning, perhaps including placing a memo or letter or reproach in that individual's personnel file. Or, they can do nothing. Observing a coworker lose his or her job because you informed Human Resources officials of that coworker's transgression is not pleasant. You have no control over how H.R. will respond to reports of misconduct. Each individual must decide for his- or herself how to respond to information or observations incriminating fellow human beings.

How does education shape an individual's personality?

Education is a process by which the mind changes. Information in our minds is organized in networks, called schemas. Educational experiences alter those schemas through processes that Jean Piaget identified as assimilation, where new information is assimilated into old schemas, and accommodation, where schemas have to change to accommodate new information. A classic example among children is the baby that knows what a dog is. The child who owns a poodle sees a chihuahua for the first time and someone identifies that as a dog. The essential schema does not have to change to accommodate the new information. On the other hand, the same child sees a cat and says "doggie!" An adult corrects the child saying, "no, that's a kitty." The schema for "dog" has to change in order to differentiate between cat and dog. This is the essential process of learning.

Yet the process of education is not neutral. Those who control educational processes, such as teachers, administrators, school districts, and other institutions (government, religious organizations, corporations, etc.) tend to shape what gets taught based on their political values. A good example would be the young people in Nazi Germany who were required to join the Hitler youth organizations. They were taught to hate certain kinds of people, which means that for a time, hatred was a part of some of their personalities.

Personalities are also influenced by educational practices when some students are identified as successful while others are identified as failures. Often these identifications are based not so much on intelligence but on the social expectations schools have for students as well as the limitations on teaching strategies within schools. For example, with high stakes testing predominant in the United States, classroom activities tend to focus on how to pass the test. Teaching processes may include a lot of practice with worksheets, which means children are sitting for long periods of time. This set of expectations does not work for children who are identified as having attention deficit disorder. These students, then, may be made to feel like failures even though they may be very intelligent and creative. This sense of failure may influence the personality on a lifelong basis.

Critical thinking is a process by which people can reflect on what they have learned and how they have been taught. To a certain extent, it can allow people to consider whether they want to continue to be influenced by the ideas they have learned. Some people are natural critical thinkers, resisting the kind of education that goes against their values. Others can benefit from learning how to analyze what they have learned and the political values behind it.

Educational experiences can, thus, affect personalities and emotions, but these effects do not have to be permanent.

How does O. Henry widen the vision of the reader in addition to telling interesting stories?

O. Henry's short but powerful short stories are masterpieces of irony, as the outcome of the stories often involves an unexpected twist. For example, in "Heart and Hands," the man who the reader thinks is the marshal winds up being the prisoner. 

O. Henry's stories also widen our vision because they challenge our prejudices and preconceived notions. For example, in "Heart and Hands," the reader might assume that the attractive character, Mr. Easton, is the...

O. Henry's short but powerful short stories are masterpieces of irony, as the outcome of the stories often involves an unexpected twist. For example, in "Heart and Hands," the man who the reader thinks is the marshal winds up being the prisoner. 

O. Henry's stories also widen our vision because they challenge our prejudices and preconceived notions. For example, in "Heart and Hands," the reader might assume that the attractive character, Mr. Easton, is the representative of the law. However, although he is young and handsome, he is the prisoner. At the end of the story, the reader learns that his or her prejudices have been wrong and that the less attractive, older member of the pair on the train is the marshal and that Easton is the prisoner. In "Gifts of the Magi," a young couple named Jim and Della buy Christmas gifts for each other that don't work out. Jim buys Della combs for her hair, but she has cut off her hair to buy him a chain for the watch he sold to buy her the combs. This story expands our vision because it makes us realize that our preconceived notions of what we need to buy on Christmas--that is, material goods--are often flawed. Instead, as Jim and Della realize, the ultimate gift they can give each other is love. 

In A Streetcar Named Desire, what important information does Blanche reveal? What is suggested by the character's name?

When considering the character of Blanche, she is marked more so by what she does not reveal about herself than by what she reveals. Her false modesty and Southern charm are tools that she uses to obscure who she really is. Part of what annoys her brother-in-law, Stanley, about her, aside from her education and higher-class status, is her pretension.

The only information that Blanche willingly reveals is that Belle Reve, the family plantation, has...

When considering the character of Blanche, she is marked more so by what she does not reveal about herself than by what she reveals. Her false modesty and Southern charm are tools that she uses to obscure who she really is. Part of what annoys her brother-in-law, Stanley, about her, aside from her education and higher-class status, is her pretension.

The only information that Blanche willingly reveals is that Belle Reve, the family plantation, has been lost. Belle Reve stands, not only for the DuBois family's former prestige, but is an emblem of the Old South. During the postwar period, in which the play takes place, the Old South had collapsed: the plantation system (in which slaves were replaced by sharecroppers) eroded, and black people achieved civil rights -- albeit slowly and with much resistance.

To save Belle Reve and, perhaps also to hold on to her senses of youth and desirability, Blanche frequents a hotel called The Flamingo where she hires herself out as an escort. This information, uncovered by Stanley, stands in stark contrast to the self-image she presents. Her name, Blanche DuBois, is of French origin and translates as "white woods," or even "the white woman of the woods," due to "blanche" being the feminine form of "blanc" and "du" translating to English as "from the."  The name signifies purity and innocence (white), but also obscurity (the woods). Hence, Blanche's senses of purity and innocence rely mostly on what she hides from others and from herself.

What is the exposition in Jacob Have I Loved by Katherine Paterson?

The exposition of a story shows the setting, characters, and background information.  In Jacob Have I Loved, the setting is the island of Rass, which is a fictional place in the Chesapeake Bay.  Louise, the main character, rarely leaves the island.  The story takes place during the 1940s.

Louise and her twin sister, Caroline, are the two main characters.  The story centers around the bitterness Louise has toward her sister.  These negative feelings go...

The exposition of a story shows the setting, characters, and background information.  In Jacob Have I Loved, the setting is the island of Rass, which is a fictional place in the Chesapeake Bay.  Louise, the main character, rarely leaves the island.  The story takes place during the 1940s.

Louise and her twin sister, Caroline, are the two main characters.  The story centers around the bitterness Louise has toward her sister.  These negative feelings go back to the day they were born:

What my mother bore him was girls, twin girls.  I was the elder by a few minutes.  I always treasured the thought of those minutes.  They represented the only time in my life when I was the center of everyone's attention.  From the moment Caroline was born, she snatched it all for herself. (Chapter 2)

Secondary characters are Louise and Caroline's parents and grandmother.  Louise's best friend, Call, is also an important character.  Louise is closer to her father, who treats her like a son.  Together, they go crabbing.  Her mother is kind and loving.  Her grandmother is frequently negative and judgmental.  The Captain arrives on the island, and he also becomes a friend to Louise.

Does the low level of unemployment indicate that the labor market is in good shape?

While a low unemployment rate is almost always better than a high unemployment rate, a low unemployment rate does not necessarily mean that the labor market is in good shape.  This is because of the way that unemployment is defined.  Because of the way that we define unemployment, people can be in unfavorable economic situations without being unemployed.  Let us look at two ways in which this could be so.

First, people could be working,...

While a low unemployment rate is almost always better than a high unemployment rate, a low unemployment rate does not necessarily mean that the labor market is in good shape.  This is because of the way that unemployment is defined.  Because of the way that we define unemployment, people can be in unfavorable economic situations without being unemployed.  Let us look at two ways in which this could be so.

First, people could be working, but in situations where they are underemployed.  Someone might wish to work full time, but only be able to get a part-time job.  Someone might be working two low-wage jobs just to get by.  A person with a college degree might be working in a job that requires no more than a high school diploma and for which they are overqualified.  All of these people are in bad situations and yet they are simply counted as “employed.”

Second, it is possible to not be working and still not count as unemployed.  One group of people like this is called discouraged workers.  These people do not have jobs, but they have given up and have stopped trying to find jobs.  They keep failing to find a job so they stop looking.  You have to be looking for a job to count among the unemployed, so a discouraged worker is not unemployed.  That person is simply not part of the labor force.

When there are large numbers of discouraged workers and/or people who are underemployed, the unemployment rate can be low even though the labor market really is not in good shape.

What is E.E. Cummings' poem "kitty sixteen 5'11 white prostitute" about?

This poem, convoluted and abbreviated in typical Cummings style, is a homage to individuality, a portrait of Kitty herself, and an admonishment to her “Johns” – a description of the less obvious benefits of associating with girls of ill repute. Cummings is looking at the real 16 year-old person, past the automatic assumptions of her occupation, to the real human being underneath one’s first public impression. Cummings is saying that the real pleasures of her...

This poem, convoluted and abbreviated in typical Cummings style, is a homage to individuality, a portrait of Kitty herself, and an admonishment to her “Johns” – a description of the less obvious benefits of associating with girls of ill repute. Cummings is looking at the real 16 year-old person, past the automatic assumptions of her occupation, to the real human being underneath one’s first public impression. Cummings is saying that the real pleasures of her company are the innocent smiles (“skilled in quick softness. Unspontaneous. cute.”), the gentle touches, the vulnerability of her presence – a noble homage to all individuality. “Art is looking at things carefully,” Cummings asserts, and here he has turned the mundane obvious impression into art, by looking carefully at this 16-year-old life “whose least amazing smile is the most great/ common divisor of unequal souls.”  Cummings' sensitivity, even grace, is displayed in these kinds of works -- a nonjudgmental, sensitive soul under the superficial grammatical variation in his expression.

You might also want to look at “Maggie and Millie and Molly and May,” another portrait of the humans behind their superficial identities.

Is it important to the story that we should know what Margot's thoughts and feelings are?

Since the emotional impact of the story depends on how strongly we identity with her, it is important that we know what Margot's thoughts and feelings are. What Bradbury tries to do is drive a wedge between how the other children view Margot and how we as readers do. The children view her as an Other, an outsider, as one who won't join in their games, and they envy her for her memories of sunshine....

Since the emotional impact of the story depends on how strongly we identity with her, it is important that we know what Margot's thoughts and feelings are. What Bradbury tries to do is drive a wedge between how the other children view Margot and how we as readers do. The children view her as an Other, an outsider, as one who won't join in their games, and they envy her for her memories of sunshine. The reader, however, is encouraged to feel sympathy for her as a lonely and sensitive child who wants nothing more than to feel the sun again, so much so that her parents may leave Venus early to take her home. The more acutely we feel Margot's intense longing for the upcoming time in the sun, which occurs only once in seven years, the greater the impact when the children lock her in the closet so that she misses it. If we don't care about Margot, it won't matter to us that she loses her chance at the sun, and the whole story will fizzle out. Most readers, however, feel Margot's pain, which is why we are still reading the story decades after it was published.

What crime has Mead committed?

On the surface, Mead has committed the crime of walking for the sake of walking. In this repressed society, citizens are discouraged or maybe even forbidden from walking or leaving their homes at night. The impression is that there is a universal curfew. That is, people must be in their homes by a certain time every night. This is strikingly similar to a prison lifestyle. So, Mead is simply out when he is supposed to...

On the surface, Mead has committed the crime of walking for the sake of walking. In this repressed society, citizens are discouraged or maybe even forbidden from walking or leaving their homes at night. The impression is that there is a universal curfew. That is, people must be in their homes by a certain time every night. This is strikingly similar to a prison lifestyle. So, Mead is simply out when he is supposed to be inside. An obedient citizen should be inside, watching thoughtless television shows. 

But it is not just that Mead is out when he should be in. His seemingly innocuous habit of walking at night actually threatens the authorities. His habit is a direct challenge to their authority. There is only one police car because crime is nearly extinct. To keep crime at this low level, the police want no one on the streets. This story suggests that the total elimination of crime comes at the expense of individual and social freedom.

If everyone is basically a prisoner in his/her own home, no crimes will be committed. The catch is that no one is free to do as he/she pleases. Leonard has committed no real crime (from the logical reader's perspective). But within the context of this story, he has threatened authorities with his nightly habit of temporarily escaping from his cell (home). 

Was there conflict between Sidi and Sadiku throughout the play?

There are several scenes throughout the play that depict conflict between Sidi and Sadiku. When Sadiku first goes to the village to ask if Sidi will marry Baroka, Sidi tells Sadiku to hold her breath because she is not interested. Sidi goes on to explain that she thinks Baroka only wants to marry her because she is famous. Sadiku is both shocked and offended at Sidi's arrogance.Sadiku believes that Lakunle has filled Sidi's head...

There are several scenes throughout the play that depict conflict between Sidi and Sadiku. When Sadiku first goes to the village to ask if Sidi will marry Baroka, Sidi tells Sadiku to hold her breath because she is not interested. Sidi goes on to explain that she thinks Baroka only wants to marry her because she is famous. Sadiku is both shocked and offended at Sidi's arrogance. Sadiku believes that Lakunle has filled Sidi's head with crazy thoughts and Sadiku threatens to beat Lakunle. Sidi stands up for Lakunle, then begins to boast about her beauty. Sidi then tells Sadiku that the Bale's skin is too old for her and begins to criticize Baroka's aging physique. Sadiku comments that Sidi must be possessed by angry gods, but Sidi continues to reject Baroka's proposal and invitation to his feast. Later on in the novel, after Sidi loses her virginity to Baroka, Sidi runs onto the stage and throws herself to the ground. Sidi looks up at Sadiku and calls her a fool because Sadiku was tricked by Baroka. When Sidi admits that she is not a maid, Sadiku shows no sympathy for her and tells her to cheer up. The audience can tell that Sadiku does not care for Sidi and views her as arrogant, and Sidi feels that Sadiku is stupid for believing Baroka's lie. There is obvious tension between Sidi and Sadiku throughout the play, and the only reason Sadiku seems happy for Sidi is because Sadiku is no longer the Bale's head wife.

What is the subject of poem "The Chimney Sweeper"?

This poem is a harsh and justifiable critique of child labor. During Blake's lifetime, children were often used to climb through the flues in order to sweep the chimneys out. Boys as young as four years old were trained to do this. This was, of course, very dangerous. Children could be injured and even killed as a result of burns, cancer, and suffocation. 

In the poem's first stanza, the child is so young he can...

This poem is a harsh and justifiable critique of child labor. During Blake's lifetime, children were often used to climb through the flues in order to sweep the chimneys out. Boys as young as four years old were trained to do this. This was, of course, very dangerous. Children could be injured and even killed as a result of burns, cancer, and suffocation. 

In the poem's first stanza, the child is so young he can not yet say "sweep." He can only say "weep" which is tragically fitting since it resembles crying. The sound is also evocative of a baby bird crying for food or for its mother. This underscores how vulnerable these children are. 

The speaker of the poem tells us about one such child, Tom Dacre. Some child sweeps would also get stuck in the chimneys. Those that come out would be soot-stained and could have inflamed eyes. Tom has a nightmare about other sweeps stuck in black coffins. The experience of being stuck in the chimney is compared to that of being in a coffin. 

Then Tom dreams of an angel coming to rescue them all. He imagines them being free on a green plain. This symbolizes a freedom in life, to run and play as children should. Then he pictures them rising upon clouds, perhaps a reference to the heavenly afterlife. A more morbid interpretation of these dreams is that the only escape for the child worker is through death and dreams. 

Do you think Shylock deserves the treatment given to him in the trial scene in The Merchant of Venice? Act 4, scene 1.

You could go either way in your answer to this question.  It does not matter if you think yes or no.  What matters is that you back up your position with reasons and evidence from the text.  

You could answer yes, and say that Shylock deserves the treatment in the court proceedings because Shylock is a jerk.  He's mean to his daughter, he hates people simply based on their religion, and he charges ridiculous...

You could go either way in your answer to this question.  It does not matter if you think yes or no.  What matters is that you back up your position with reasons and evidence from the text.  

You could answer yes, and say that Shylock deserves the treatment in the court proceedings because Shylock is a jerk.  He's mean to his daughter, he hates people simply based on their religion, and he charges ridiculous interest on his loans in order to make more money.  

You could say no, Shylock does not deserve the treatment he gets at the trial, because he is on the receiving end of an intentional manipulation of the laws.  He is strung along and made to believe one thing only to have the situation pull a complete 180 a minute later.   The court proceeding is a mockery of a judicial system, and even though Shylock is a jerk, he still deserves a fair day in court. 

How is the grandmother characterized early on in A Good Man is Hard to Find?

The grandmother, in the first part of the story, is characterized as having anxieties--she worries about news reports of the Misfit being on the loose and sneaks her cat into the car for the road trip because she fears he might "accidentally asphyxiate himself." However, she is anything but a scaredy-cat. She asserts herself forcefully and energetically and does what she can to get her own way, including using reports of the Misfit to try,...

The grandmother, in the first part of the story, is characterized as having anxieties--she worries about news reports of the Misfit being on the loose and sneaks her cat into the car for the road trip because she fears he might "accidentally asphyxiate himself." However, she is anything but a scaredy-cat. She asserts herself forcefully and energetically and does what she can to get her own way, including using reports of the Misfit to try, unsuccessfully, to get the family to vacation in east Tennessee rather than Florida. Her anxieties come from her engagement with the world: she reads the newspaper, knows what's happening in the world, and cares about her cat. She is also characterized as annoying--the children treat her with disrespect, her daughter-in-law ignores her and her granddaughter characterizes her as needing to be at the center of things: "Afraid she'd miss something. She has to go everywhere we go." There's a pathos in the grandmother too, who has to tolerate a second-hand, dismissive treatment to be part of this family which tolerates her more than it embraces her. 

When does Winston first realize that O'Brien is directing his torture?

In Part Three, Chapter One, amid the many beatings he has endured, O'Brien appears to Winston in his cell and reveals himself as the director of his torture. For Winston, O'Brien's true identity is a fact that, deep down, he had always known:

"Yes, he saw now, he had always known it."

At this particular time, however, Winston does not fully grasp O'Brien's role. This happens in the next chapter (Chapter Three) when he is...

In Part Three, Chapter One, amid the many beatings he has endured, O'Brien appears to Winston in his cell and reveals himself as the director of his torture. For Winston, O'Brien's true identity is a fact that, deep down, he had always known:

"Yes, he saw now, he had always known it."

At this particular time, however, Winston does not fully grasp O'Brien's role. This happens in the next chapter (Chapter Three) when he is taken to a bright room where O'Brien appears with a man in a "white coat." It is in this room that Winston makes this important realisation about O'Brien:

"All through his interrogation, although he had never seen him, he had had the feeling that O’Brien was at his elbow, just out of sight. It was O’Brien who was directing everything."

He realises that O'Brien is the master of his torture: that he controls when he is tortured, for how long and by what means. He will also decide if and when Winston is killed. But O'Brien is not interested in killing Winston, it is his plan to make him love Big Brother.

Summarize the poem "Madam and Her Madam" by Langston Hughes.

In this humorous poem by poet Langston Hughes, a woman named Alberta, who works as a household servant, speaks in the first person about the duties she is required to perform for her employer, whom she calls "Madam." The speaker must clean the 12-room house, cook three meals a day, take care of the children, walk the dog, and do the laundry. The speaker confronts her employer about the enormous work load, asking her whether...

In this humorous poem by poet Langston Hughes, a woman named Alberta, who works as a household servant, speaks in the first person about the duties she is required to perform for her employer, whom she calls "Madam." The speaker must clean the 12-room house, cook three meals a day, take care of the children, walk the dog, and do the laundry. The speaker confronts her employer about the enormous work load, asking her whether she is trying to make a "pack-horse" out of her. This question implies that the employer is taking advantage of Alberta, requiring her to do more work than is humanly possible or is kind.

The employer responds by denying the charge, and then professes her love for Alberta. In the humorous last stanza, Alberta acknowledges that her employer probably does love her, but that she does not return the sentiment. In fact, she says, "I'll be dogged if I love you." This is a euphemism and a slang term used for emphasis--there is no way an employee who is saddled with an impossible workload can be expected to love her oppressor.

One gets the impression that Alberta is a feisty and energetic woman who has been trying to do her best but finally comes to the conclusion that no matter how hard she tries, she will never be able to meet the unreasonable demands placed on her. The poem also fights against the stereotype of the cheerful black "help" on whom wealthy white women depended so that they would not have to lift a finger doing unpleasant tasks. This poem encourages overworked household staff to stand up for themselves and be honest about their limits and their feelings.

In chapter 1 of The Great Gatsby, what does Daisy's behavior reveal about her character?

In Chapter One, Daisy shows herself to be childish, snobby, self-centered, and cynical.  Despite the fact that Nick was away fighting in the war, she is irritated that he didn't attend her wedding. Further, she describes her first reaction to learning that she'd had a little girl (it was tears), and she says that she hopes her daughter will be a fool because

"the best thing a girl can be in this world [is] a...

In Chapter One, Daisy shows herself to be childish, snobby, self-centered, and cynical.  Despite the fact that Nick was away fighting in the war, she is irritated that he didn't attend her wedding. Further, she describes her first reaction to learning that she'd had a little girl (it was tears), and she says that she hopes her daughter will be a fool because

"the best thing a girl can be in this world [is] a beautiful little fool.'"

Daisy doesn't express any affection let alone love for her daughter with these words; instead, she manages to turn the news of her daughter's birth into one more way to complain about her own lot in life because she feels unhappy and put-upon and used. 

The more Daisy complains about the state of the world -- a world which exists to serve her due to her wealth and status -- the more snobby and childish she sounds until, finally, she looks at Nick

"with an absolute smirk on her lovely face, as if she had asserted her membership in a rather distinguished secret society to which she [...] belonged." 

Daisy knows how much power she wields, and her confidence is supreme because no one ever disagrees with her. 

Do the Zoroastrians dispose of their dead in the towers of silence because of a shortage of burial space?

Formally, Zoroastrians dispose of their dead in the Towers of Silence for religious reasons. They believe that the dead body is unclean and to bury it would pollute the earth. Similarly, cremation might pollute the fire or air. Placing the bodies up  high where they are exposed to the sun and carrion birds allows for the remains to be disposed of or "recycled" in a way that prevents the spiritual pollution of the environment. 

This...

Formally, Zoroastrians dispose of their dead in the Towers of Silence for religious reasons. They believe that the dead body is unclean and to bury it would pollute the earth. Similarly, cremation might pollute the fire or air. Placing the bodies up  high where they are exposed to the sun and carrion birds allows for the remains to be disposed of or "recycled" in a way that prevents the spiritual pollution of the environment. 

This means of disposing of the dead has been practiced for at least three thousand years. However, it is predated by the practices of cremation and embalming before burial. Because of this, one might assume that the practice arose as a response to a lack of space for interment. That would make sense from a structural-functionalist point of view, and it is a possibility. It is also possible that there were negative consequences, such as spread of disease, which resulted from burial in the ground or in tombs. This desire to prevent the spread of disease or avoid the smell of decomposition is at the root of most burial traditions. Open-air burial is just the way that Zoroastrian people prefer to do it, believing it is the best possible means of disposal of the dead.

`int x sin^3(x) dx` Evaluate the integral

You need to use integration by parts, such that:

`int u dv = uv - int vdu`

`u = x => du = dx`

`dv = sin^3 x => v = int sin^3 x dx`

You need to solve the integral `int sin^3 x dx ` such that:

`int sin^3 x dx = int sin^2 x* sin xdx`

Replace 1` - cos^2 x` for `sin^2 x` , such that:

`int sin^2 x* sin xdx =...

You need to use integration by parts, such that:

`int u dv = uv - int vdu`

`u = x => du = dx`

`dv = sin^3 x => v = int sin^3 x dx`

You need to solve the integral `int sin^3 x dx ` such that:

`int sin^3 x dx = int sin^2 x* sin xdx`

Replace 1` - cos^2 x` for `sin^2 x` , such that:

`int sin^2 x* sin xdx = int (1 - cos^2 x)* sin xdx`

Use substitution` cos x = t => -sin x dx = dt:`

`int (1 - cos^2 x)* sin xdx = int (1 - t^2)* (-dt)`

`int (1 - t^2)* (-dt) = int (t^2 - 1) dt`

`int (t^2 - 1) dt = int t^2 dt - int dt`

`int (t^2 - 1) dt = t^3/3 - t + c`

Replace back cos x for t:

`int (1 - cos^2 x)* sin x dx =  (cos^3 x)/3 - cos x + c`

Hence, `v = int sin^3 x dx = (cos^3 x)/3 - cos x`

Using parts, yields:

`int x sin^3 x dx = x*((cos^3 x)/3 - cos x) - int ((cos^3 x)/3 - cos x) dx`

`int x sin^3 x dx = x*((cos^3 x)/3 - cos x) - int (cos^3 x)/3 dx + int cos x dx`

You need to solve the integral `int (cos^3 x)/3dx` , such that:

`int (cos^3 x)/3dx = (1/3) int cos^2 x*cos x dx`

Replace `1 - sin^2 x ` for `cos^2 x:`

`(1/3) int (1 - sin^2 x)*cos x dx`

Use substitution `sin x = t => cos x dx = dt`

`(1/3) int (1 - sin^2 x)*cos x dx = (1/3)*int (1 - t^2) dt = (1/3) t - (1/3)(t^3)/3 + c`

`(1/3) int (1 - sin^2 x)*cos x dx = (1/3) sin x- (1/3)(sin^3 x)/3 + c`

Hence, the result of integration is: `int x sin^3 x dx = x*((cos^3 x)/3 -cos x) - ((1/3) sin x- (1/3)(sin^3 x)/3) + sin x + c`

Please provide a few man vs. society quotes from Fahrenheit 451.

The society that exists in Fahrenheit 451 does not appreciate academic learning, in-depth reading, and quality education. They have evolved into a society that demands pleasure over learning, visual and audio entertainment over reading, and recreation, such as driving fast cars, over education. Anyone behaving differently than this hedonist standard of living is considered antisocial or a misfit. For example, Clarisse McClellan is a 17 year-old girl who behaves differently because she has an uncle who...

The society that exists in Fahrenheit 451 does not appreciate academic learning, in-depth reading, and quality education. They have evolved into a society that demands pleasure over learning, visual and audio entertainment over reading, and recreation, such as driving fast cars, over education. Anyone behaving differently than this hedonist standard of living is considered antisocial or a misfit. For example, Clarisse McClellan is a 17 year-old girl who behaves differently because she has an uncle who teaches her about life before the current society. Beatty describes how she as an individual was viewed by society:

"She was a time bomb. The family had been feeding her subconscious, I'm sure, from what I saw of her school record. She didn't want to know how a thing was done, but why. That can be embarrassing" (60).

Clarisse was different, so they got rid of her. She really was an innocent victim because she had no defense against a society that didn't like her individuality and free-thinking spirit.

Next, Montag is at odds with society as well. He looks around at his life and feels as if something is missing. He notices a few things about society that disturb him and he tells his friend Faber about them as follows:

"Nobody listens any more. I can't talk to the walls because they're yelling at me. I can't talk to my wife; she listens to the walls. I just want someone to hear what I have to say. And maybe if I talk long enough, it'll make sense" (82).

The above passage shows that Montag struggles against the accepted norms in society that seem to divide people rather than bring them together. In an effort to explain things to Montag, Faber says the following:

"The whole culture's shot through. The skeleton needs melting and reshaping. . .The public itself stopped reading of its own accord. You firemen provide a circus now and then at which buildings are set off and crowds gather for the pretty blaze, but it's a small sideshow indeed, and hardly necessary to keep things in line" (87).

Faber's explanation centers around the fact that people, not a controlling, evil government, are the problem with society. Values have shifted since before the wars and the change of society. Faber used to teach college English, and he saw a decline in interest and appreciation for literature until finally it was outlawed. A shift in society's whole mind frame brought down the quality and value of literature, deep thinking, philosophy, and the like. When society went one way, there were only a few individuals who held onto the old values. The few in Fahrenheit 451 who fight against society, then, are Clarisse, Faber, and Montag.

Describe the dramatic roles of Sidi, Baroka, and Lakunle in the play The Lion and the Jewel.

Sidi is the village belle and the object of Lakunle and Baroka's affection throughout the play The Lion and the Jewel.She is a beautiful girl but is conceited and rather simple. After seeing her images in a magazine, she becomes full of herself. Sidi refuses to marry Lakunle and even rejects Baroka's marriage proposal. Sidi believes Sadiku's rumor that the Bale is impotent and visits Baroka to mock him. Unsuspectingly, the Bale is...

Sidi is the village belle and the object of Lakunle and Baroka's affection throughout the play The Lion and the Jewel. She is a beautiful girl but is conceited and rather simple. After seeing her images in a magazine, she becomes full of herself. Sidi refuses to marry Lakunle and even rejects Baroka's marriage proposal. Sidi believes Sadiku's rumor that the Bale is impotent and visits Baroka to mock him. Unsuspectingly, the Bale is able to charm Sidi, and she loses her virginity to Baroka. Sidi then accepts the fact that she is no longer a maid and decides to marry Baroka instead of Lakunle.

Baroka is the aging Bale in the village of Ilujinle. He is the most highly esteemed member of the village, and is the wisest character throughout the play. Although Baroka embraces traditional African customs, he is not fully opposed to modernization and progress. Baroka comes up with a cunning plan to win Sidi's heart by telling his head wife, Sadiku, that he is impotent. Sadiku is a notorious gossip, and the Bale knows that she will spread the rumor about his condition. His plan works to perfection, and Sidi enters his room under the belief that he cannot perform sexually. He charms Sidi by showing her a stamp machine and promises that her image will adorn every stamp coming from Ilujinle. Baroka successfully woos Sidi and he eventually marries her at the end of the play.

Lakunle is the village school teacher who values Western civilization and is a proponent of modernization and progress. He tries to come across as intelligent by using "big words," but the majority of the community views him as a madman and fool. He has grandiose ideas regarding the future of Ilujinle and strictly opposes traditional customs. Lakunle refuses to pay the bride-price and initially tells Sidi that it is a savage custom. He comes across as shallow and insincere at the end of the play when it is revealed that his true intention was simply to avoid paying the bride-price. He does not marry Sidi, and quickly forgets her as he chases another young maid during the wedding ceremony.

In "Shooting An Elephant," how did the Burmese people express their feelings towards British people?

That the Burmese hate the British is made very clear in "Shooting an Elephant" and, in this essay, Orwell provides a number of examples to support this claim.

In the bazaar (the market), for instance, the Burmese would "spit betel juice" on the dress of a European woman and the priests would "jeer" when out on a street corner. In another example, Orwell talks about a football game in which he was tripped up by...

That the Burmese hate the British is made very clear in "Shooting an Elephant" and, in this essay, Orwell provides a number of examples to support this claim.

In the bazaar (the market), for instance, the Burmese would "spit betel juice" on the dress of a European woman and the priests would "jeer" when out on a street corner. In another example, Orwell talks about a football game in which he was tripped up by a Burmese man while the referee ("another Burman") did nothing. 

It is, perhaps, interesting to note that the Burmese demonstrate their hate towards the British through a number of small, localised incidents. They do not, as Orwell states, have "the guts to raise a riot." Instead, they act when they encounter a British person alone and when they have the safety of other Burmese people to rely on. This is very telling of the nature of imperialism: the Burmese know that outright rebellion would only lead to suffering and harsh punishment and they are not prepared to take that sort of risk. 

If Christopher Columbus had never landed in North America, what would have happened to the culture, economy, religion, demographics and relations...

Of course, we will never be able to know for sure what would have happened if Christopher Columbus had not “discovered” the New World.  However, I am as certain as I can be that the course of history would not have changed significantly if Columbus’s three ships had been lost at sea or if he and his men had been massacred by natives when they landed.  Some European explorer would inevitably have come across the Americas and history would have played out roughly as it did in our world.

By the late 1400s, European countries had a strong incentive to explore and they had the best technology in the world with which to do dominate the people that they “discovered.”  European countries were hungry for spices and people who could bring those spices to their markets could make tremendous amounts of money.  For this reason, mariners were strongly motivated to explore and to see if they could find ways to get to places that had spices.  The Europeans were also motivated by the desire to find gold and other precious metals and to convert people to Christianity.  These things meant that Europeans would have kept exploring even if Columbus’s expedition had never returned.

If the Europeans kept exploring, they would inevitably have found the Americas.  If they found the Americas, they would surely have dominated its people.  They had technology that was vastly superior to the technology that the natives had.  They had guns, steel weapons, horses, writing, and other useful technologies that the natives lacked.  Moreover, they carried with them the germs of infectious diseases that would have decimated the native populations whenever they came in contact with Europeans.  In other words, there is no way that the natives of the Americas would have been able to effectively resist large numbers of Europeans for long.

With all this in mind, it is impossible for me to imagine any plausible scenario in which the Europeans did not come to dominate the Americas.  Because the Europeans would inevitably have come to dominate the New World, none of the things you mention would have turned out significantly differently if Columbus had never landed in the Americas.

Who wrote the gospel of Mark and why?

The authorship of the gospels is tricky, as they were all initially anonymous before later tradition ascribed authors to them. The Gospel of Mark is, originally, anonymous. We attach Mark to this particular gospel because the bishop Papias of Hierapolis did so around the year 100, himself referring an earlier tradition:

Mark, in his capacity as Peter’s interpreter, wrote down accurately as many things as he recalled from memory—though not in an ordered form—of the...

The authorship of the gospels is tricky, as they were all initially anonymous before later tradition ascribed authors to them. The Gospel of Mark is, originally, anonymous. We attach Mark to this particular gospel because the bishop Papias of Hierapolis did so around the year 100, himself referring an earlier tradition:

Mark, in his capacity as Peter’s interpreter, wrote down accurately as many things as he recalled from memory—though not in an ordered form—of the things either said or done by the Lord.

If this is to be believed, as the Church traditionally has, then the Gospel of Mark was written by the disciple Mark as an account of St. Peter’s recollections. The Gospel of Mark holds an interesting place in Christian scripture as the oldest canonical gospel and one of the direct sources for two of the other canonical gospels, the Gospels of Luke and Matthew. According to biblical scholarship, the Gospel of Mark was used as a basis for material for both Luke’s and Matthew’s gospels.

As for why, the Gospel of Mark seems to be written to reach Greek Christians who were mostly unfamiliar with Judaism and the Jewish context for a Messiah. The author of this gospel certainly wrote for a Greek-speaking Christian audience, as the language itself was Greek and the author explains Jewish customs and Aramaic terms to his readers. Interestingly, many scholars discredit Papias and his claim that the contents of the gospel were based on Peter's recollection; making that link would in turn make the Gospel of Mark a more authoritative and reliable document. 

How did Christopher Columbus impact North America's culture, demographics, religion, and relations with other regions of the world?

We tend to overestimate the importance of Christopher Columbus as an individual.  Columbus himself had very little impact on any of the things you mention in your question.  He was merely the first European to lead a voyage that resulted in colonization in the New World.  He never even saw the continent of North America.  Rather than saying that Columbus affected North America, we should say that the Europeans who came after Columbus affected North...

We tend to overestimate the importance of Christopher Columbus as an individual.  Columbus himself had very little impact on any of the things you mention in your question.  He was merely the first European to lead a voyage that resulted in colonization in the New World.  He never even saw the continent of North America.  Rather than saying that Columbus affected North America, we should say that the Europeans who came after Columbus affected North America in the following ways:

• Demographics.  In much of North America, the Europeans killed most Native Americans or, at the very least, moved them onto small pieces of remote land.  This paved the way for much of North America to be inhabited by Europeans and their descendants.  In Mexico, the Europeans did not kill as many natives and, instead, mingled with them, creating a country that is most mestizo.


• Culture.  Because so few Native Americans remain in the US and most of Canada, we can say that their culture was basically destroyed and replaced by a culture based on European culture.  In Mexico, a hybrid culture blending European and Indian influences arose.


• Religion.  This is a part of culture. Native American religions essentially disappeared over most of North America, even in Mexico.  In the US and Canada, Europeans settled most of the land and were barely affected (if they were at all) by Indian religions.  In Mexico, Indian religions have influenced Christianity much more, leading to celebrations such as the Day of the Dead.


• Relations with the rest of the world.  Before Columbus, the Native Americans had no relations with other regions of the world.  After the Europeans came, North America became a major part of the world as a whole, leading to the situation today in which the US is the most powerful country in the world.

Great Expectations is one of the first books to look seriously at a child's experience from a child's direct perspective. What do we learn from...

From Pip we learn that children experience real emotions, and adults are affected by their childhood experiences.

Charles Dickens was very sympathetic to children.  He often includes child narrators in his books, or includes child characters.  Pip is telling his story as an adult looking back on his experiences as a child.  He gives his child self credit for having real emotions and opinions, and acknowledges the emotional scars his childhood left on him.

An...

From Pip we learn that children experience real emotions, and adults are affected by their childhood experiences.

Charles Dickens was very sympathetic to children.  He often includes child narrators in his books, or includes child characters.  Pip is telling his story as an adult looking back on his experiences as a child.  He gives his child self credit for having real emotions and opinions, and acknowledges the emotional scars his childhood left on him.

An example of this is Pip’s guilt.  Pip was a worrier.  As a child, he was often overcome by guilt for even the most minor misdeeds.  Thus when he did something major, like helping the convict or fighting with Herbert Pocket, he was convinced that he was going to be arrested straight away.

I felt that the pale young gentleman's blood was on my head, and that the Law would avenge it. Without having any definite idea of the penalties I had incurred, it was clear to me that village boys could not go stalking about the country, ravaging the houses of gentlefolks and pitching into the studious youth of England, without laying themselves open to severe punishment. (Ch. 7)

Pip’s feelings of guilt are a defining factor.  They are partly due to his youth and lack of understanding of the way the world works, but partly due to his personality.  His adult self does not ignore it.  He dwells on it, because he still suffers from the same self-doubts in some respects that his child self did.  The child we were influences the adult we become.  The nagging worry of Pip’s childhood affected the adult he turned into.

A child’s experiences directly influence his future sometimes.  Pip’s experience with Magwitch was a formative one, and one of chance.  Miss Havisham was a very important part of Pip's childhood.  He was trapped.  She made sure that she had him there as a training device for Estella in his formative years, teaching him how to fall in love.

"Is she beautiful, graceful, well-grown? Do you admire her?"

"Everybody must who sees her, Miss Havisham."

She drew an arm round my neck, and drew my head close down to hers as she sat in the chair. "Love her, love her, love her! How does she use you?" (Ch. 29)

Pip and Estella learn how to love in a very dysfunctional way.  We see through the child Pip’s eyes what Miss Havisham is doing to him.  His experiences have value.  He is being very poorly treated, and it will affect him for life.

Which line from "The Leap" foreshadows what happens during the storm?

Anna’s daughter narrates “The Leap” to tell the story of her mother’s life, which includes several examples of both literal and metaphorical “leaps of faith.”

Anna describes the weather on the day of the circus tent collapse in great detail by speaking about the collision of weather fronts and the resulting changes. The line that foreshadows what is to happen is as follows:

That afternoon, as the anticipation increased, as Mr. and Mrs. Avalon tied...

Anna’s daughter narrates “The Leap” to tell the story of her mother’s life, which includes several examples of both literal and metaphorical “leaps of faith.”

Anna describes the weather on the day of the circus tent collapse in great detail by speaking about the collision of weather fronts and the resulting changes. The line that foreshadows what is to happen is as follows:

That afternoon, as the anticipation increased, as Mr. and Mrs. Avalon tied sparkling strips of cloth onto each other's face and as they puckered their lips in mock kisses, lips destined “never again to meet,” as one long breathless article put it, the wind rose, miles off, wrapped itself into a cone, and howled.

Both Avalons took a blind leap that day, but it was part of their act and neither expected anything to go awry. Because of the foreshadowing, the reader knows the couple will never be whole again, as their act is interrupted by the weather. As they flew through the air, lightning hits the pole holding up the circus tent. Harold Avalon, Anna’s husband, was killed in the accident, and Anna was injured. This tragic accident forever changes Anna’s life.

Explain why a $100 reduction in taxes does not have the same impact on output and employment as a $100 increase in government spending.

A tax cut of $100 does not have the same impact as a $100 increase in government spending because there is not the same initial increase in GDP.  That is, a $100 increase in government spending increases GDP by $100 right away whereas the $100 tax cut does not. 

When the government increases spending by $100, it buys goods or services from individuals with that $100.  This $100 is directly applied to GDP because it...

A tax cut of $100 does not have the same impact as a $100 increase in government spending because there is not the same initial increase in GDP.  That is, a $100 increase in government spending increases GDP by $100 right away whereas the $100 tax cut does not. 

When the government increases spending by $100, it buys goods or services from individuals with that $100.  This $100 is directly applied to GDP because it takes the form of a government purchase of new goods or services.  The multiplier then takes effect as people who get money for providing goods and services to the government turn around and spend that money.  If we use this information to derive the multiplier mathematically, we find that the equation for the multiplier is 1/(1-MPC) where MPC is the marginal propensity to consume.

When the government decreases taxes by $100, there is no direct effect on GDP.  The government is refraining from taking money instead of actually paying it out to buy goods and services.  This does not increase GDP.  The tax cut first increases GDP when taxpayers spend some of the money saved to buy goods and services.  They will only spend some of it, though, because they will want to save the rest.  Therefore, the multiplier has to be lower than the government expenditures multiplier. 

So, the tax cut does not increase GDP as much as the government spending does.  This is because government spending counts towards GDP whereas a tax cut does not.

How could the relationship between Piggy and Simon be described?

Although Piggy and Simon both display similar character traits, they do not share a mutual respect for one another. Both characters support Ralph and value civilization, but like the other boys on the island, Piggy finds Simon to be strange and weird.Simon is considered an outcast among the boys and is ridiculed by the others for being clumsy and shy and for acting differently. Despite his reputation for being a strange boy, Simon treats...

Although Piggy and Simon both display similar character traits, they do not share a mutual respect for one another. Both characters support Ralph and value civilization, but like the other boys on the island, Piggy finds Simon to be strange and weird. Simon is considered an outcast among the boys and is ridiculed by the others for being clumsy and shy and for acting differently. Despite his reputation for being a strange boy, Simon treats others with respect. Simon goes out of his way to help Piggy grab his glasses from the rocks after Jack smacks them off of his face and also volunteers to walk through the forest to tell Piggy the location of the hunting party. Simon looks up to Piggy and wishes to be his friend, but Piggy looks down on Simon as an outcast. Piggy does not hate Simon, but he does view him with contempt.

How strong would I have to be to be able to pull a syringe that's been pushed all the way to squeeze all the air out of the tube and sealed shut so...

The plunger of a 60 mL syringe has been pushed all the way through to expel any air and its end has been sealed. The plunger now has to be pulled down to the 60 ml mark. The syringe is at sea level and it is strong enough to withstand the force exerted when the plunger is pulled down without the walls caving in.

At sea level, the atmospheric pressure is 101325 N/m^2. When the...

The plunger of a 60 mL syringe has been pushed all the way through to expel any air and its end has been sealed. The plunger now has to be pulled down to the 60 ml mark. The syringe is at sea level and it is strong enough to withstand the force exerted when the plunger is pulled down without the walls caving in.

At sea level, the atmospheric pressure is 101325 N/m^2. When the plunger of the syringe is pulled down, a vacuum is created. As a result, the surrounding air exerts a force on the plunger to push it back up. Pressure is force exerted per unit area. In the problem the cross sectional area of the plunger is not given. As a result, it is not possible to determine the force required to pull t down. Assuming the area of cross section as 1*10^-5 m^2, the force required to pull down the plunger is 1.01325 N. This force does not change as the plunger is moved lower and the vacuum is maintained.

The total work done to create the vacuum in 60 mL is equal to 101325*6*10^-5 = 6.0795 J.

According to Romeo in Shakespeare's Romeo and Juliet,what sort of youth is Mercutio?

First, it is clear from the text that Romeo has a deep affection for Mercutio who is, it is clear, his best friend. When Tybalt kills Mercutio, Romeo is so overcome with rage that he throws aside his love for Juliet to avenge his friend. At the same time, Romeo believes (correctly, it seems) that Mercutio is a sort of anti-romantic who cannot understand the depths of his love for Juliet. "He," Romeo says after...

First, it is clear from the text that Romeo has a deep affection for Mercutio who is, it is clear, his best friend. When Tybalt kills Mercutio, Romeo is so overcome with rage that he throws aside his love for Juliet to avenge his friend. At the same time, Romeo believes (correctly, it seems) that Mercutio is a sort of anti-romantic who cannot understand the depths of his love for Juliet. "He," Romeo says after a bit of ribbing from his friend, "jests at scars that never felt a wound." From his frequent ribald jokes, it is clear that Mercutio is a bit of a rake who views love in sexual terms. Romeo seems to realize this, even if Mercutio has a point when he mocks Romeo for his moping over his unrequited love for Rosaline. Romeo is also aware, as is the audience, of his friend's propensity for talking. Mercutio never shuts up, and Romeo tells him at the end of his famous Queen Mab speech in the first act that he "talk'st of nothing." In perhaps his most telling quote about Mercutio, Romeo describes his friend to the Nurse as 

A gentleman, nurse, that loves to hear himself talk and will speak more in a minute than he will stand to in a month.

What would be a suitable essay topic for the first chapter of Ehrenreich's Nickel and Dimed, "Serving in Florida"?

To avoid simply summarizing the chapter, I think you could easily pull out a theme that appears heavily in this chapter and that you will find reoccurring throughout this text. For instance, you could write about how Ehrenreich must face some harsh realities about poverty in this first chapter. She begins her job search thinking she can pick and choose from among the low-wage jobs she knows of; she starts out remembering her waitressing experiences...

To avoid simply summarizing the chapter, I think you could easily pull out a theme that appears heavily in this chapter and that you will find reoccurring throughout this text. For instance, you could write about how Ehrenreich must face some harsh realities about poverty in this first chapter. She begins her job search thinking she can pick and choose from among the low-wage jobs she knows of; she starts out remembering her waitressing experiences as a teenager and thinks this is the one job she does not want. Of course, this is the one she ends up having to take. She also begins her experiment believing she will have no problem finding a job paying $7 per hour and being able to find a place to rent for $500-$600 per month; she is unsuccessful at both. She sees others at her restaurant job suffer fears of deportation, struggle with homelessness, and live with a myriad of other difficulties that all stem from poverty.

This chapter is a hard dose of the reality that Ehrenreich thought she already knew. I think centering your essay around the misconceptions that she had going into her experiment would make a great framework.

What rumors have been told about Gatsby?

In the early chapters of The Great Gatsby, Nick hears all sorts of rumors about Gatsby. In Chapter Two, for example, Myrtle's sister, Catherine, claims that Gatsby is the "nephew or cousin" of the German Emperor, Kaiser Wilhelm. 

Similarly, in Chapter Three, Nick attends a party at Gatsby's house and hears a number of other rumors about Gatsby's background. One guest called Lucille claims that Gatsby was a German spy during the war while...

In the early chapters of The Great Gatsby, Nick hears all sorts of rumors about Gatsby. In Chapter Two, for example, Myrtle's sister, Catherine, claims that Gatsby is the "nephew or cousin" of the German Emperor, Kaiser Wilhelm. 

Similarly, in Chapter Three, Nick attends a party at Gatsby's house and hears a number of other rumors about Gatsby's background. One guest called Lucille claims that Gatsby was a German spy during the war while another says that Gatsby is a graduate of Oxford university. Somebody else spreads the rumor that Gatsby has killed a man.

These wild rumors continue into Chapter Four when it is suggested by a young lady that Gatsby is a "bootlegger" while another declares that Gatsby killed a man who knew that he was "a nephew to Von Hindenberg and second cousin to the devil." 

While the rumors are varied and numerous, each one has the same purpose: it builds suspense ahead of Gatsby's introduction to the reader and, later, to how he built his immense fortune. 

What is a good quote from The Odyssey that shows a time when Athena uses her strength over her intelligence?

In The Odyssey, Athena, the daughter of Zeus and goddess of wisdom, often uses her divine powers to disguise her appearance and meddle in the affairs of the mortals.  Although she is regarded as the “goddess of wisdom,” there are instances in the epic that show Athena relying on her strength as an immortal as opposed to her intelligence.   When Athena enters Odysseus’ home, she takes on the persona of Mentes to tell Telemachus...

In The Odyssey, Athena, the daughter of Zeus and goddess of wisdom, often uses her divine powers to disguise her appearance and meddle in the affairs of the mortals.  Although she is regarded as the “goddess of wisdom,” there are instances in the epic that show Athena relying on her strength as an immortal as opposed to her intelligence.   When Athena enters Odysseus’ home, she takes on the persona of Mentes to tell Telemachus that his father is still alive.  However, she is met with disgruntled and drunk suitors, and her strength is manifested:

“[Athena] caught up a powerful spear, edged with sharp bronze, heavy, huge, thick, wherewith she beats down the battalions of fighting men, against whom she of the mighty father is angered, and descended in a flash of speed from the peaks of Olympia, and lighted in the land of Ithaca, at the doors of Odysseus at the threshold of the court, and in her hand was the bronze spear. She was disguised as a friend, leader of the Taphians, Mentes” (1.99-105).

This quote showcases Athena’s strength instead of her wisdom because she takes on the persona of a powerful male—a seemingly unnecessary step since she could easily remove the suitors from Odysseus’ home on her own abilities.  It seems as if she is more concerned with appearing powerful as opposed to accomplishing the task at hand which would end all of the fighting—announcing to Telemachus that his father has returned home to Ithaca. 

Balance the following reactions, identify the type of reaction and indicate which reactions are oxidation-reduction reactions. Also if you could...

Balanced Reactions:

Rxn 1: `~BaCl_2 + ~Na_2SO_4 -gt ~BaSO_4 + ~2NaCl`

Rxn 2: `~2AgNO_3 + ~Na_2CO_3 -gt ~Ag_2CO_3 + ~2NaNO_3`

Rxn 3: `~Cu(NO_3)_2 + ~Na_2CO_3 -gt ~CuCO_3 + ~2NaNO_3`

Rxn 4: `~2Al(NO_3)_3 + ~3Na_2CO_3 -gt ~Al_2(CO_3)_3 + ~6NaNO_3`

Rxn 5: `~H_2SO_4 + ~Na_2CO_3 -gt ~Na_2SO_4 + ~H_2O + ~CO_2`

Types of Reactions:

• All of the reactions can be classified as double replacement reactions. Double replacement reactions take the general form: AB + CD -> AD + CB. The reactants and products in a double replacement reaction are all compounds. In reaction 5, the original products in the reaction would have been the compounds: `~Na_2SO_4` + `~H_2CO_3` . The `~H_2CO_3` then decomposed into `~H_2O` + `~CO_2` .

• Reactions 1, 2, 3, and 4 can also be classified as precipitation reactions. You can identify a precipitation reaction by noticing that an insoluble product is formed from two ionic aqueous solutions.

• Reaction 5 can also be classified as an acid-base reaction. The reactant `~H_2SO_4` is an acid and the other reactant `~Na_2CO_3` is a base. We know that this is not a precipitation reaction because no insoluble products are formed.

• None of the reactions is an oxidation-reduction reaction because none of the oxidation numbers in any of the reactions change from the reactant to the product side of the equation.

Example: Let's work through an example using Reaction 1.

`~BaCl_2 + ~Na_2SO_4 -gt ~BaSO_4 + ~NaCl`

Balancing the Reaction:

Step 1: Make a list of the number of each type of atom on the reactant and product sides of the equation.

Reactants       Products

Ba: 1             Ba: 1

Cl: 2              Cl: 1

Na: 2             Na: 1

S: 1               S: 1

O: 4               O: 4

Step 2: Add coefficients to balance the number of atoms on both sides of the equation.

Notice that Cl is unbalanced. Ask yourself "What number can I place in front of the compound on the product side containing the Cl, that when multiplied by the subscript of Cl will equal 2?" The answer is 2. So, we will place a coefficient of 2 in front of NaCl on the product side of the equation. This changes the number of Cl atoms to 2 and also changes the number of Na atoms to 2.

`~BaCl_2 + ~Na_2SO_4 -gt ~BaSO_4 + ~2NaCl`

Reactants       Products

Ba: 1             Ba: 1

Cl: 2              Cl: 2

Na: 2             Na: 2

S: 1               S: 1

O: 4               O: 4

The reaction is now balanced.

Type of Reaction:

First, rule out that the reaction is an oxidation-reduction reaction by assigning each element in the reaction an oxidation number. The list of rules for assigning elements oxidation numbers can be found online or in your textbook. If there is no rule for a particular element, you must figure it out based on the total charge of the compound or polyatomic ion.

`~BaCl_2 + ~Na_2SO_4 -gt ~BaSO_4 + ~2NaCl`

On the reactant side of the equation, the oxidation numbers are:

Ba: +2 , Cl: -1, Na: +1, S: +6, O: -2

On the product side of the equation, the oxidation numbers are:

Ba: +2, Cl: -1, Na: +1, S: +6, O: -2

Since none of the oxidation numbers changed, the reaction is not an oxidation-reduction reaction.

The fact that both of the reactants are ionic aqueous solutions and that an insoluble product is formed, tells us that the reaction is a precipitation reaction. We also know that a reaction with the general form of AB + CD -> AD + CB, is an example of a double replacement reaction.

Is Polonius a co-conspirator in Hamlet?

Whether or not Polonius is a co-conspirator in William Shakespeare’s Hamlet depends on what you consider a co-conspirator. Indeed, in most adaptations of Shakespeare’s work and in the Bard’s play itself, Polonius is not directly named as a co-conspirator in Hamlet’s father’s assassination. In Act II, Scene II, however, Polonius does in fact conspire with King Claudius to spy on Hamlet and discover if Hamlet’s madness is genuine or feigned. In a key exchange with...

Whether or not Polonius is a co-conspirator in William Shakespeare’s Hamlet depends on what you consider a co-conspirator. Indeed, in most adaptations of Shakespeare’s work and in the Bard’s play itself, Polonius is not directly named as a co-conspirator in Hamlet’s father’s assassination. In Act II, Scene II, however, Polonius does in fact conspire with King Claudius to spy on Hamlet and discover if Hamlet’s madness is genuine or feigned. In a key exchange with Claudius, Polonius admits he will do whatever he can to get to the heart of matters:

“Take this from this, if this be otherwise:

If circumstances lead me, I will find

Where truth is hid, though it were hid indeed

Within the centre”

(http://shakespeare.mit.edu/hamlet/full.html).

He does eventually spy on Hamlet, which inadvertently leads to his demise. In Act III, Scene IV, Polonius hides behind drapes within Queen Gertrude’s closet. When he is discovered, Hamlet slays Polonius, thinking instead that he may have murdered Claudius. When Queen Gertrude chastises him for murdering Polonius, Hamlet draws the act back to her supposed betrayal of his father:

"A bloody deed! almost as bad, good mother,

As kill a king, and marry with his brother" (http://shakespeare.mit.edu/hamlet/full.html).

In summation, there is no firm evidence that Polonius has a hand in Hamlet’s father’s murder. However, Polonius does conspire to spy on Hamlet, so in that sense he could be labeled a co-conspirator.

How does the quote "Well, girl, thou weep'st not so much for his death" show that Lady Capulet and Juliet's relationship is weak?

In Act 3, Scene 5, Juliet is crying because Romeo had to leave her, to head to Mantua, where he’s been banished. They just had their wedding night, but when the sun came up, he had to leave quickly so that no one would see him and put him to death. Now she doesn’t know if she’ll ever see him again, and she’s terribly sad about it.

But remember, also, that her cousin Tybalt recently...

In Act 3, Scene 5, Juliet is crying because Romeo had to leave her, to head to Mantua, where he’s been banished. They just had their wedding night, but when the sun came up, he had to leave quickly so that no one would see him and put him to death. Now she doesn’t know if she’ll ever see him again, and she’s terribly sad about it.

But remember, also, that her cousin Tybalt recently got killed (by Romeo—which is why he’s banished!) When Juliet’s mom finds her crying, she assumes that it’s because Juliet is still upset about her cousin’s murder.

Juliet’s mom, Lady Capulet, says:

“Well, girl, thou weep’st not so much for his death,

As that the villain lives which slaughtered him.”

What she means is, “You’re not really crying over Tybalt’s death now, it’s more like you’re crying because the guy who killed him is still alive.” Which is really funny! Because it’s Romeo who killed Tybalt. Obviously Juliet’s not upset about Romeo still being alive!

But what this misunderstanding shows us is that Juliet has a weak relationship with her mom. She doesn’t keep her mom in the loop about what’s going on in her life. If they were close, if they had the same kind of warm, loving relationship that Juliet and her nurse do, then Juliet’s mom would obviously know why Juliet is so upset. But instead, Lady Capulet doesn’t even know that Juliet loves Romeo or that they even got married.

What quotes are there to prove Macbeth is irrational?

Prior to the murder, Macbeth hallucinates a dagger, and he does actually recognize that it is a hallucination.  He calls it "a false creation, / Proceeding from the heat-oppressèd brain" (2.1.39-40).  Even in very stressful moments, it is not normal to hallucinate.  The hallucination, then, makes it seem as though Macbeth is no longer rational.

Then, after the murder, Macbeth flips out.  He feels like he heard a disembodied voice shouting out in his house,...

Prior to the murder, Macbeth hallucinates a dagger, and he does actually recognize that it is a hallucination.  He calls it "a false creation, / Proceeding from the heat-oppressèd brain" (2.1.39-40).  Even in very stressful moments, it is not normal to hallucinate.  The hallucination, then, makes it seem as though Macbeth is no longer rational.

Then, after the murder, Macbeth flips out.  He feels like he heard a disembodied voice shouting out in his house, "'Glamis hath murdered sleep, and therefore Cawdor / Shall sleep no more. Macbeth shall sleep no more'" (2.2.42-43).  This is an irrational fear, to think that because he murdered someone while they were sleeping that he will no longer be able to sleep.  If anything prevents him from sleeping, it will most likely be guilt. 

Lady Macbeth realizes that Macbeth has brought the murder weapons out of the room with him instead of leaving them with the grooms they plan to frame, but Macbeth refuses to go back into the room with Duncan's body.  He says, "I’ll go no more: / I am afraid to think what I have done; / Look on ’t again I dare not" (2.2.50-53).  It is irrational to be willing to commit a brutal and bloody murder and yet not even be able to look at the body of the victim.  His qualms are seriously misplaced. 

Finally, he fears that if he plunged his hands into the ocean, the quantity of blood on them would turn the green sea red.  He wonders, "Will all great Neptune’s ocean wash this blood / Clean from my hand? No, this my hand will rather / The multitudinous seas incarnadine, / Making the green one red" (2.2.61-64).  Such a thought could simply be an exaggeration that he makes in order to express just how guilty and awful he feels, but even his wife has warned him against dwelling on what has occurred in order to preserve his own mental state.  She says, "These deeds must not be thought / After these ways. So, it will make us mad" (2.2.33-34).  Initially, at least, Macbeth is not able to take this advice, and he seems quite irrational both before and after the murder.