First, we need to write out the complimentary strand to the strand shown. We can already tell, just by looking at the strand provided, that vir1 will be encoded on one of the strands, and vir2 will be coded on the complimentary strand; we know this because each sequence needs to begin with the DNA sequence TAC, but in the strand provided, there are two TAC sequences that are too close together to provide both...
First, we need to write out the complimentary strand to the strand shown. We can already tell, just by looking at the strand provided, that vir1 will be encoded on one of the strands, and vir2 will be coded on the complimentary strand; we know this because each sequence needs to begin with the DNA sequence TAC, but in the strand provided, there are two TAC sequences that are too close together to provide both a 10 and a 5 residue product.
Following the GCAT pairing rules, we get the double strand:
1. AGATCGGATGCTCAACTATATGTGATTAACAGAGCATGCGGCATAAACT
2. TCTAGCCTACGAGTTGATATACACTAATTGTCTCGTACGCCGTATTTGA
We know strand one must be read right-to-left, because this is the only way a TAC sequence appears. Therefore, strand 2 must be read left-to-right. The TAC sequences are highlighted below:
1. AGATCGGATGCTCAACTATATGTGATTAACAGAGCATGCGGCATAAACT
2. TCTAGCCTACGAGTTGATATACACTAATTGTCTCGTACGCCGTATTTGA
Since it's not immediately obvious which TAC is the correct one, we can look for stop sequences as well. Stop, in DNA, is encoded by TAG, TAA and TGA
1. AGATCGGATGCTCAACTATATGTGATTAACAGAGCATGCGGCATAAACT
2. TCTAGCCTACGAGTTGATATACACTAATTGTCTCGTACGCCGTATTTGA
If we look carefully at these sequences, we can eliminate some that are situated in such a way that they are incompatible with the TAC sequences and with the 10 and 5 residue products we expect. Some of them are also not found in the same 3-base sequence when counted from a given TAC starting point. However, none of the possible sequences provide a 10-residue or 5-residue product. I believe this was due to the original sequence being written or assigned incorrectly; researching this question online shows that it appears in multiple forms, some of which are not possible to transcribe using the criteria shown. Furthermore, other versions of this question show the original sequence as being 5' to 3', and since DNA is always transcribed 5' to 3', this means a TAC sequence needs to be visible in left-to-right viewing in order for this question to be solved.
No comments:
Post a Comment